Latest Publication In The miRNA Field:

by christoph on September 2, 2009

{ 0 comments }

Nominate your favorite microRNA

by Chris on March 5, 2010

Leave a comment naming your favorite microRNA and a quick explanation of why its your favorite. 

The winner will be featured as the “microRNA of the week” in an upcoming post.

{ 2 comments }

microRNA as a New Immune-Regulatory Agent in Breast Milk

Background

Breast milk is a complex liquid that provides nutrition to the infant and facilitates the maturation of the infant’s immune system. Recent studies indicated that microRNA (miRNA) exists in human body fluid. Because miRNAs are known to regulate various immune systems, we hypothesized that human breast milk contains miRNAs that may be important for the development of the infant’s immune system.

Findings

We profiled miRNA expression in human breast milk and detected high expression levels of immune-related miRNAs in the first 6 months of lactation. Furthermore, these miRNA molecules are stable even in very acidic conditions, indicating that breast milk allows dietary intake of miRNAs by infants.

Conclusions

Our findings provide new insight into how breast milk can modulate the development of the infant’s immune system. This study suggests the transfer of genetic material as miRNA from human to human occurs by means other than through sexual reproduction.

Kosaka N, Izumi  H, Sekine K, Ochiya T. (2010) microRNA as a new immune-regulatory agent in breast milk. Silence [Epub Ahead of Print]. [abstract]

{ 0 comments }

microRNA of the Week: microRNA-451

by Chris on February 26, 2010

Hypoxia and monocrotaline induced strong upregulation of miR-451 suggesting a role in the development of pulmonary arterial hypertension (PAH)1, a complex disorder leading to right-sided heart failure and death. Head and neck squamous cell carcinomas (HNSCC) constitute the fifth most common malignancy worldwide. Significant downregulation of miR-451 was observed in relapsed HNSCC patients suggesting that downregulation of miR-451 could be a viable candidate marker for HNSCC2. Underexpression of miR-451 has been associated with worse prognosis in gastric cancer, with macrophage inhibitor factor suggested as its potential mRNA target3. Increasing Evidence has suggested that bronchioalveolar stem cell (BASC) is the progenitor cells of lung cancer stem cells. It has been shown that BASCs possess a unique miRNA profile, with altered expression of several microRNAs, such as miR-451 in BASCs compared to control cells. These results suggest that microRNAs might play important roles in maintaining the self-renewal capacity of BASCs, and that aberrant expression of microRNAs could be involved in turning BASCs into lung cancer stem cells4. Finally, miR-451 seems to be a key molecule in normal erythroid differentiation and has also been shown to regulate the multidrug resistance 1 gene in cervix, ovarian, and breast cancer cell lines5.

  1. Caruso P, Maclean MR, Khanin R, McClure J, Soon E, Southwood M, McDonald RA, Greig JA, Robertson KE, Masson R, Denby L, Dempsie Y, Long L, Morrell NW, Baker AH. (2010) Dynamic Changes in Lung MicroRNA Profiles During the Development of Pulmonary Hypertension Due to Chronic Hypoxia and Monocrotaline. Arterioscler Thromb Vasc Biol [Epub ahead of print] [abstract]
  2. Hui AB, Lenarduzzi M, Krushel T, Waldron L, Pintilie M, Shi W, Perez-Ordonez B, Jurisica I, O’Sullivan B, Waldron J, Gullane P, Cummings B, Liu FF. (2010) Comprehensive MicroRNA profiling for head and neck squamous cell carcinomas. Clin Cancer Res. 16(4):1129-39. [abstract]
  3. Bandres E, Bitarte N, Arias F, et al. (2009) microRNA-451 regulates macrophage migration inhibitory factor production and proliferation of gastrointestinal cancer cells. Clin Cancer Res 15:2281–90. [abstract]
  4. Qian S, Ding JY, Xie R, An JH, Ao XJ, Zhao ZG, Sun JG, Duan YZ, Chen ZT, Zhu B. (2008) MicroRNA expression profile of bronchioalveolar stem cells from mouse lung. Biochem Biophys Res Commun 377(2), 668-73. [abstract]
  5. Kovalchuk O, Filkowski J, Meservy J, Ilnytskyy Y, Tryndyak VP, Chekhun VF, Pogribny IP. (2008) Involvement of microRNA-451 in resistance of the MCF-7 breast cancer cells to chemotherapeutic drug doxorubicin. Mol Cancer Ther 7(7), 2152-59. [abstract]

{ 0 comments }

microRNA Deal Struck

February 25, 2010

Regulus Therapeutics and GlaxoSmithKline Establish New Collaboration to …
MarketWatch (press release)‎
Regulus Therapeutics Inc. today announced the establishment of a new collaboration with GlaxoSmithKline (GSK) to develop and commercialize microRNA …
Market Report — In Play (GSK)
MSN Money
GlaxoSmithKline and Regulus Therapeutics establish new collaboration to develop and commercialize microRNA Therapeutics Targeting miR-122 Co and Regulus …
Regulus, the [...]

Read the full article →

microRNA of the week: microRNA-29

February 19, 2010

There are several groups making headlines that are studying the mir-29 family.
Rosetta Genomics
Headlines – Joint Study By Rosetta Genomics And NYU Langone Medical Center Identifies Single MicroRNA Biomarker For Prognosis Of Mesothelioma Patients
Single microRNA exhibits potential to forecast outcomes of MPM 
The results clearly demonstrate that higher levels of miR-29c* in MPM predict a more favorable [...]

Read the full article →

Upcoming miRNA Conference: microRNA in Human Disease & Development

February 16, 2010

Monday, March 22nd – Wednesday, March 24 – 2010 in Cambridge, MA – USA
miRNA as Diagnostic Biomarkers and Targets for Therapeutic Development
TOPICS INCLUDE:
microRNA in Cancer
microRNA in Biomarker and Diagnostic Development
microRNA in Therapeutic Development
microRNA in Human Development and Disease
microRNA Pathways and Mechanisms
PRE-CONFERENCE SHORT COURSE:
microRNA Identification, Profiling and Validation Techniques

Subscribe to the comments for this post?

Email this [...]

Read the full article →

microRNA of the week: microRNA-206

February 12, 2010

When you consider that microRNAs have now been linked to almost every biological function, how is it possible that the detection of microRNAs had escaped scientists for so long? For example, a single microRNA, miR-206 with functions that range from estrogen regulation to suppression of breast cancer metastasis to regulation of neuromuscular signaling. Amazing!

Williams AH, [...]

Read the full article →

The many complex roles of microRNA in breast cancer

February 10, 2010

There have been several studies involving microRNAs and breast cancer to date.  The findings of these studies collectively demonstrate the wide range of function that microRNA can play in just a single disease.  Researchers at Baylor College of Medicine and the University of Houston found that dysregulation of certain microRNAs have significant effect on morphological [...]

Read the full article →

New expression analysis software tool: Expander

February 8, 2010

EXPANDER (EXpression Analyzer and DisplayER) is a java-based tool for analysis of gene expression data[1].

data preprocessing and normalization
identification of differential genes
clustering and biclustering;
down-stream enrichment analyses of:

GO functional categories
TF binding sites in promoter regions
microRNA sites in 3′-UTRs
chromosomal locations

network-based analysis of the expression data

Expander (EXPression ANalyzer and DisplayER) is an integrated software platform for the analysis of [...]

Read the full article →

microRNA of the Week: microRNA-21

February 5, 2010

5′ – uagcuuaucagacugauguuga – 3′
This week we take a look at an interesting microRNA that has widespread regulatory function and has also been in the headlines of late. microRNA-21 has been linked to a variety of diseases, including cancer, fibrosis, and heart disease and is therefore a potential target for a number of therapeutic indications. [...]

Read the full article →