Latest Publication In The miRNA Field:

by christoph on September 2, 2009

{ 0 comments }

EXPANDER (EXpression Analyzer and DisplayER) is a java-based tool for analysis of gene expression data[1].

  • data preprocessing and normalization
  • identification of differential genes
  • clustering and biclustering;
  • down-stream enrichment analyses of:
    • GO functional categories
    • TF binding sites in promoter regions
    • microRNA sites in 3′-UTRs
    • chromosomal locations
  • network-based analysis of the expression data

Expander (EXPression ANalyzer and DisplayER) is an integrated software platform for the analysis of gene expression data, which is freely available for academic use. It is designed to support all the stages of microarray data analysis, from raw data normalization to inference of transcriptional regulatory networks.

microRNA target predictions for Human, Mouse, Fly, and C. elegans

  1. Ulitsky I, Maron-Katz A, Shavit S, Sagir D, Linhart C, Elkon R, Tanay A, Sharan R, Shiloh Y, Shamir R. (2010) Expander: from expression microarrays to networks and functions. Nat Protoc 5(2), 303-22. [abstract]

{ 0 comments }

microRNA of the Week: microRNA-21

by Chris on February 5, 2010

5′ – uagcuuaucagacugauguuga – 3′

This week we take a look at an interesting microRNA that has widespread regulatory function and has also been in the headlines of late. microRNA-21 has been linked to a variety of diseases, including cancer, fibrosis, and heart disease and is therefore a potential target for a number of therapeutic indications. Generally, microRNA-21 is overexpressed in most human cancers and downregulates the expression of many tumor suppressors. There are many cancer control genes that are targeted by micro-211. microRNA-21 has a protective effect against ischemia-induced cardiac myocyte damage and may play critical roles in the early phase of acute myocardial infarction2. Also, the potential for microRNA-21 involvement in a major diabetic complication was demonstrated as its expression was downregulated in response to early diabetic nephropathy3. It seems there are clearly clinical applications for this microRNA as companies race to stake their IP claims. Last week two groups issued press releases touting the USPTO’s allowance of their claims related to microRNA-21.

January 25, 2010 – Regulus, Alnylam and Isis Announce U.S. Allowance of Tuschl III Patent Application Covering miR-21

“ miR-21 Patent Allowance Strengthens Regulus Leadership in microRNA Therapeutic Drug Development”

January 29, 2010  -Rosetta Genomics Fortifies Patent Position with U.S. Allowance of Claims Covering Human microRNAs miR-21 and hcmv-miR-UL112

“Rosetta Genomics owns or has access to intellectual property related to microRNAs that is among the broadest of any commercial entity, and these two notices of allowance further solidify our position”

  1. Wickramasinghe NS, Manavalan TT, Dougherty SM, Riggs KA, Li Y, Klinge CM. (2009) Estradiol downregulates miR-21 expression and increases miR-21 target gene expression in MCF-7 breast cancer cells. Nucleic Acids 37(8), 2584-95.  [abstract]
  2. Dong S, Cheng Y, Yang J, Li J, Liu X, Wang X, Wang D, Krall TJ, Delphin ES, Zhang C. (2009) MicroRNA expression signature and the role of microRNA-21 in the early phase of acute myocardial infarctionJ Biol Chem [Epub ahead of print].  [abstract]
  3. Zhang Z, Peng H, Chen J, Chen X, Han F, Xu X, He X, Yan N. (2009) MicroRNA-21 protects from mesangial cell proliferation induced by diabetic nephropathy in db/db mice.  FEBS Lett 583(12), 2009-14.  [abstract]

{ 0 comments }

miRNAtools

by Chris on February 2, 2010

miRNAtools

This page is a compilation of several tools to analyze miRNA sequences, determine their targets and to analyze their possible roles in cellular metabolism. The user can follow TUTORIALS that show how to extract information on miRNA function by using real and theoretical examples.

{ 0 comments }

MicroRNAs…not fossils

February 2, 2010

The last ancestor we shared with worms lived 600 million years ago and may already have had a sophisticated brain that released hormones into the blood and was connected to various sensory organs. The evidence comes not from a newly found fossil, but from the study of microRNAs in a group of animals alive today [...]

Read the full article →

How many unique mature human miRNAs are there?

January 29, 2010

The results of the last poll are in…
Considering that the current miRBase version 14 includes 894 unique mature human miRNAs – how many are there really in us? 74% of our readers believe that there are more than 1000 miRNAs. So, let’s discover the rest…

Subscribe to the comments for this post?

Email this to a friend?

Add [...]

Read the full article →

microRNA of the Week: microRNA-146a

January 29, 2010

While it is clear now that microRNAs play an important regulatory role in nearly all areas of biology, what may be more interesting is the breath of function of just a single microRNA.  It is estimated that microRNAs regulate up to 60% of all genes and some say that “each microRNA can target hundreds of [...]

Read the full article →

Regulus, Alnylam and Isis Announce U.S. Allowance of Tuschl III Patent Application Covering miR-21

January 25, 2010

Business Wire 1/25/09
The newly allowed claims cover miR-21, a microRNA that has been linked to a variety of diseases, including cancer, fibrosis, and heart disease. The claims additionally encompass single-stranded and double-stranded antisense compounds complementary to miR-21. The allowance of this second Tuschl III patent in the U.S. extends the scope of this patent estate, [...]

Read the full article →

Deep Sequencing – a Tool for Novel microRNA Discovery in Many Species

January 8, 2010

One of the limitations of microarray expression profiling is the requirement of prior sequence information, to be used for probe design.  Until recently, this has been limited mostly to that found in public databases (i.e. miRBase), these data having been gathered mainly through a combination of bioinformatics and extensive cloning experiments.  In contrast, deep sequencing [...]

Read the full article →

Site Poll Results

January 7, 2010

The question was: “How do you like our site?”
The result:
A total of 15 votes were cast and a whooping 80% are happy with the site. I guess, this means we will be doing more of the same

Subscribe to the comments for this post?

Email this to a friend?

Add this to Google Bookmarks

Share this on [...]

Read the full article →

Upcoming Scheduled Maintenance, New Features & Numbers

December 28, 2009

For a change some housekeeping:

Blog will be down Dec. 31st 2009 – back (latest) January 2nd 2010
New Feature: miRNA related polls coming (weekly or biweekly)
Visitor stats: ~5000 unique visitors in last 14 months

I started this site Nov. 2008 and over the last couple of months I delayed a some maintenance issues thinking the holiday season would [...]

Read the full article →