The results of the last poll are in…
Considering that the current miRBase version 14 includes 894 unique mature human miRNAs – how many are there really in us? 74% of our readers believe that there are more than 1000 miRNAs. So, let’s discover the rest…
June 2013 UPDATE: miRBase 20 was released June 2013 and lists 2555 unique mature human miRNAs.
Subscribe to the miRNA blog
Thank you for subscribing.
Something went wrong.
Wow – it’s been just 9 month since this poll and we are already at 1212 (miRBase 16) unique mature miRNA for human…
As of yesterday miRBase (version 17) lists 1733 unique mature miRNA for human…
miRBase 18 was released last November and lists 1921 mature human miRNAs. To confirm the information that I am providing, go to the “browse” section at http://www.miRbase.org website and select “human”. You will find that this new release 18 includes 1527 precursors and 1921 mature miRNAs for Homo sapiens.
You are correct, the miRBase browser will show you 1921 mature human miRNAs.
However, when you look at the sequences you will notice that these are not all unique sequences – there are only 1898 truly unique mature miRNAs. This happens because different precursor molecules can result in the same mature miRNA sequence. For example, the sequence “UGUGAUAUCAUGGUUCCUGGGA” is shared by the following 3 differently named mature miRNAs: hsa-miR-3689a-5p, hsa-miR-3689b-5p, hsa-miR-3689e.
miRBase 19 was release last month (August 2012). The miRBase browser shows 2042 mature human miRNAs. However, as Christoph previously explained, there are a lower number of truly unique mature miRNA sequence but I do not know where to find that information besides than checking them one per one. Christoph, could you provide the total number of unique human mature miRNAs sequences? Thank you so much in advance.
Hi Lucrecia – miRBase 19 includes exactly 2019 unique mature human miRNA sequences. For a more comprehensive list which includes other species see here: http://www.lcsciences.com/applications/transcriptomics/mirna-profiling/mirna/mirna-available-arrays/
Hi. However a recent article from Eric Lai’s lab (Ladewig et al., 2012 Genome Research) reports the discovery of several hundreds of mirtrons (conventional, 5′- and 3′-tailed) in human and mouse. 2500 seems a good approximation at ths time.
SIr,
i m a new Phd scholar trying to work on miRNA..so i need details like wat are the miRNAs whose target and their possible diseases are not yet identified……this ll be useful for my work.pls do me the needfull..
Dear Anjana,
Q. 1: What are the miRNAs?
Ans 1: please look this review it will help you to understand biological importance of miRNAs.
http://www.gene-quantification.com/nature-reviews-microrna-2.pdf
Q. 2: what are the targets and its expression profile in disease?
Ans. 2: You can find information of miRNA target genes and expression profile (validated as well as predicted also).
https://web.archive.org/web/20160424121146/http://ferrolab.dmi.unict.it/miro/index.php
Have a fun!!!
Varun
Encode just reported more than 18K unique miRNA’s in the human genome. However consider that the 7 bp seed sequence is essential for binding which means there are 16384 possible combinations of which just over 5800 are actually present in the existing data base. Think codon usage here. While the sequence may be unique it is entirely possible that the miRNA may be regulating many genes and that a given gene may be regulated by multiple miRNA’s, eg the mapping is likely to be many to one and one to many.
Hi,
Is anyone know why the number of human miRNAs in the GENECODE version 15 are not the same of mirbase19 ?
cheers