diabetes

New study connects the cancer gene Lin28 to glucose metabolism; may shed light on unifying principles in type 2 diabetes

BOSTON, Sept. 29, 2011 /PRNewswire-USNewswire/ — A pathway activated in cancer plays an unexpected key role in metabolic diseases like type 2 diabetes, according to a study by researchers at Children’s Hospital Boston. Evidence that the Lin28/let-7 pathway influences the cellular response to glucose provides a unifying theme to perplexing data that associates human genetic variation with diabetes risk.

The multi-institutional research team led by George Q. Daley, MD, PhD, director of Stem Cell Transplantation and a leader in the Stem Cell Research Program at Children’s Hospital Boston – reported their findings in the September 30 issue of the journal Cell.

Let-7 is a microRNA, a small RNA that dampens the expression of a large set of genes related to cell growth and development. Previously, the Daley lab reported that Lin28, an RNA-binding protein found at high levels in the embryo, blocks let-7 production and is aberrantly expressed in about 15% of all cancers.

“The relationship between Lin28 and let-7 is ancient, found in organisms as diverse as worms, mice, and humans,” said Daley, a professor of biological chemistry and molecular pharmacology at Harvard Medical School [click to continue…]

{ 0 comments }

Diabetes and cancer: A shared biological basis

by Christoph on September 29, 2011

in Publications

Contrary to what you might think, cancer and diabetes appear to have some biology in common. According to a report in the September 30th issue of the Cell Press journal, Cell, a pathway that initially drew attention for its role in embryonic stem cells and cancer also influences the odds that mice develop or resist diabetes.

Mice with high levels of the cancer-promoting proteins Lin28a or Lin28b become more sensitive to insulin and less prone to diabetes when on a high-fat diet, the new study shows.

“This highlights the overlap in the biology of these disorders,” said George Daley of Harvard Medical School. “It may be the same kinds of metabolic shifts that allow cancer cells to grow are also related to [whole-body] glucose metabolism.”

In fact, there were clues about such a connection, but “no obvious mechanism,” he says. For instance, studies have shown that cancer cells within a tumor are able to grow more rapidly by shifting the way they use glucose. Genome-wide association studies for type 2 diabetes have also pinpointed several susceptibility genes with known links to cancer or the cell cycle.

Daley’s team, including first authors Hau Zhu and Ng Shyh-Chang, had noticed earlier that an immature form of the microRNA (tiny bits of RNA that silence genes by targeting messenger RNA) known as let-7 is abundant in stem cells. “It allows stem cells to be stem cells,” Zhu says.

Let-7 is also important in preventing cancer, Zhu explained, and its activity is [click to continue…]

Incoming search terms for this article:

{ 0 comments }

- Work of scientists with Regulus, Alnylam and ETH Zurich shows microRNAs 103/107 are upregulated in mouse models of obesity; targeting with anti-miRs improves glucose homeostasis and insulin sensitivity -

LA JOLLA, Calif., and CAMBRIDGE, Mass., June 8, 2011 /PRNewswire/ — Regulus Therapeutics Inc., a biopharmaceutical company leading the discovery and development of innovative medicines targeting microRNAs, and Alnylam Pharmaceuticals, Inc. (Nasdaq: ALNY), a leading RNAi therapeutics company, today announced the publication in Nature of new pre-clinical data in mice about the antagonism of microRNA-103 and microRNA-107 (miR-103/107). Data from a collaborative study performed by Regulus, Alnylam and ETH Zurich demonstrated that antagonism of miR-103/107 with proprietary chemically modified anti-miR oligonucleotides could promote insulin signaling in both liver and adipose tissue.  Silencing miR-103/107 in animal models of obesity improved glucose homeostasis, suggesting that these microRNAs are potential targets for the treatment of diabetes.

Defects in insulin signaling are among the most common and earliest defects that predispose an individual to the development of type 2 diabetes. The new findings demonstrated that miR-103/107 are upregulated in obese mice, and silencing with anti-miRs could improve glucose homeostasis and insulin sensitivity, while gain of function in liver or fat caused impaired glucose homeostasis. Direct targets of miR-103/107 identified include [click to continue…]

Incoming search terms for this article:

{ 0 comments }

Researchers at the University of Bristol have shown in an experimental cell study that conditions mimicking diabetes and a lack of blood supply to a tissue increased microRNA-503 and impaired the ability of endothelial cells, which line the interior surface of blood vessels.

Alternatively, slowing down microRNA-503 improved the capability of endothelial cells to duplicate and form into networks of small blood vessels. The researchers showed that microRNA-503 reduces cell growth and prevents the formation of blood vessels by direct binding and inhibition of cyclin E1 and Cdc25 mRNA.

Finally, using mouse models of diabetes and limb ischaemia, the researchers found that inhibition of the microRNA-503 (using a “decoy miRNA”) could restore-post-ischaemic blood flow recovery. The findings of this study highlight important clinical implications of microRNA-503 in diabetes-associated vascular complications.

Costanza Emanueli, Professorial Research Fellow in Vascular Pathology & Regeneration – “Because each microRNA can regulate many genes, they represent an exciting new target to correct diseases that have complex underlying mechanisms, like diabetes, rather than trying to target one specific gene. Our study is the first to provide evidence for a role of miRNAs in diabetes-induced defects in reparative angiogenesis.”

Caporali A, Meloni M, Völlenkle C, Bonci D, Sala-Newby GB, Addis R, Spinetti G, Losa S, Masson R, Baker AH, Agami R, le Sage C, Condorelli G, Madeddu P, Martelli F, Emanueli C. (2011) Deregulation of microRNA-503 Contributes to Diabetes Mellitus-Induced Impairment of Endothelial Function and Reparative Angiogenesis After Limb Ischemia. Circulation [Epub ahead of print]. [abstract]

Incoming search terms for this article:

{ 0 comments }

DALLAS, Sept. 17 /PRNewswire-USNewswire/ — For the first time, scientists have found that blood levels of some ribonucleic acids (microRNAs) are different among people with type 2 diabetes and those who subsequently develop the disease compared to healthy controls, according to research reported in Circulation Research: Journal of the American Heart Association1.

Changes in five specific microRNAs correctly identified most cases of diabetes and even some patients who later developed diabetes, while normal levels of these microRNAs classified 92 percent of healthy controls.

Of the microRNAs studied, microRNA 126, which promotes blood vessel growth, was among the most predictive of diabetes.

Read the entire press release

  1. Zampetaki A, Kiechl S, Drozdov I, Willeit P, Mayr U, Prokopi M, Mayr A, Weger S, Oberhollenzer F, Bonora E, Shah A, Willeit J, Mayr M. (2010) Plasma MicroRNA Profiling Reveals Loss of Endothelial MiR-126 and Other MicroRNAs in Type 2 Diabetes. Circ Res 107(6), 810-17. [abstract]

Incoming search terms for this article:

{ 0 comments }

microRNA of the Week: microRNA-21

February 5, 2010

5′ – uagcuuaucagacugauguuga – 3′ This week we take a look at an interesting microRNA that has widespread regulatory function and has also been in the headlines of late. microRNA-21 has been linked to a variety of diseases, including cancer, fibrosis, and heart disease and is therefore a potential target for a number of therapeutic [...]

Read the full article →