heart disease

Stem cell therapies promise to regenerate the infarcted heart through the replacement of dead cardiac cells and stimulation of the growth of new vessels. New research has found the transplantation of stem cells that reside in human veins can help in the recovery of a heart attack. The findings could lead, in the next few years, to the first human clinical trial.

The study, led by Professor Paolo Madeddu, Chair of Experimental Cardiovascular Medicine in the School of Clinical Sciences at the University of Bristol and colleagues in the Bristol Heart Institute, is published online in Circulation Research: Journal of the American Heart Association.

The study, funded by the British Heart Foundation (BHF) and a National Institute for Health Research (NIHR) grant, looked at whether human mural cells, known to scientists as pericytes, cells that stay around, can stabilize blood vessels after a heart attack.

The researchers, using a mouse model, have demonstrated for the first time that pericytes expanded from redundant human leg veins are able to stimulate new blood vessels (neovascularization) and help with the recovery after a heart attack.

The study found that upon transplantation pericytes relocate around the vessels of the peri-infarct zone and establish with them physical contacts allowing the transfer of genetic material, microRNA-132 (miR-132). MicroRNAs are small non-coding RNA sequences that modulate the expression of genes by binding to messenger-RNA and inhibiting it. One microRNA can inhibit many genes simultaneously. The study shows that the transfer of miR-132 from pericytes to [click to continue…]

Incoming search terms for this article:

{ 0 comments }

CLAREMONT, Calif., June 2, 2011 /PRNewswire/ — Providing a medical explanation for why exercise is good for the heart, a team of scientists from Brazil pursuing a study that started in Dr. Ian Phillips’ lab at Keck Graduate Institute (KGI) has discovered a new gene regulator called MicroRNA 29 that keeps hearts healthy even under intense exercise.

“Now, we’re beginning to get to the molecular basis of why exercise is good for you,” said Phillips, KGI’s Norris Professor of Applied Life Sciences. “It’s well known that athletes get large hearts and they remain healthy while people with large hearts, who are not athletes, are in big trouble. But we’ve never known before why they were different.”

Dr. Edilamar de Oliveira, a biochemistry professor in the Physical Education School at the University of Sao Paulo, worked with Phillips while doing postdoctoral studies at KGI from 2007-09. Applying what she learned about MicroRNAs to her research on physical training and cardiac hypertrophy after returning to Brazil, de Oliveira found MicroRNAs act as brakes on specific genes, inhibiting what proteins those genes produce.

De Oliveira and her team found that rats, who trained like athletes (two and three times a day) on a 10-week regimen involving swimming with 5% weights overload, expressed much higher levels of MicroRNA 29 than sedentary rats. And, even though the athletic rats’ hearts were enlarged, they did not develop an [click to continue…]

Incoming search terms for this article:

{ 0 comments }

microRNA of the Week: microRNA-21

by Chris on February 5, 2010

5′ – uagcuuaucagacugauguuga – 3′

This week we take a look at an interesting microRNA that has widespread regulatory function and has also been in the headlines of late. microRNA-21 has been linked to a variety of diseases, including cancer, fibrosis, and heart disease and is therefore a potential target for a number of therapeutic indications. Generally, microRNA-21 is overexpressed in most human cancers and downregulates the expression of many tumor suppressors. There are many cancer control genes that are targeted by micro-211. microRNA-21 has a protective effect against ischemia-induced cardiac myocyte damage and may play critical roles in the early phase of acute myocardial infarction2. Also, the potential for microRNA-21 involvement in a major diabetic complication was demonstrated as its expression was downregulated in response to early diabetic nephropathy3. It seems there are clearly clinical applications for this microRNA as companies race to stake their IP claims. Last week two groups issued press releases touting the USPTO’s allowance of their claims related to microRNA-21.

January 25, 2010 – Regulus, Alnylam and Isis Announce U.S. Allowance of Tuschl III Patent Application Covering miR-21

“ miR-21 Patent Allowance Strengthens Regulus Leadership in microRNA Therapeutic Drug Development”

January 29, 2010  -Rosetta Genomics Fortifies Patent Position with U.S. Allowance of Claims Covering Human microRNAs miR-21 and hcmv-miR-UL112

“Rosetta Genomics owns or has access to intellectual property related to microRNAs that is among the broadest of any commercial entity, and these two notices of allowance further solidify our position”

  1. Wickramasinghe NS, Manavalan TT, Dougherty SM, Riggs KA, Li Y, Klinge CM. (2009) Estradiol downregulates miR-21 expression and increases miR-21 target gene expression in MCF-7 breast cancer cells. Nucleic Acids 37(8), 2584-95.  [abstract]
  2. Dong S, Cheng Y, Yang J, Li J, Liu X, Wang X, Wang D, Krall TJ, Delphin ES, Zhang C. (2009) MicroRNA expression signature and the role of microRNA-21 in the early phase of acute myocardial infarctionJ Biol Chem [Epub ahead of print].  [abstract]
  3. Zhang Z, Peng H, Chen J, Chen X, Han F, Xu X, He X, Yan N. (2009) MicroRNA-21 protects from mesangial cell proliferation induced by diabetic nephropathy in db/db mice.  FEBS Lett 583(12), 2009-14.  [abstract]

Incoming search terms for this article:

{ 1 comment }

Heart disease and cancer represent the number one and number two killer diseases in developed countries. Identifying biomarkers to detect these and other diseases at early stages remains an important research goal and researchers are scrambling for ways to identify contributing factors to the pathogenesis of diseased cells in the body.  In recent years, research has turned to the study of microRNA (miRNA) as possible biomarkers due to their extensive role in biological processes and cell functionality in normal vs. diseased cells.  Microarrays combined with quantitative real-time PCR (qRT-PCR) validation are proving to be valuable tools for miRNA expression profiling and are predicted to play a crucial role in biomarker discovery and detection.  [click to continue…]

Incoming search terms for this article:

{ 0 comments }