mir-21

-Regulus Scientists to Provide Update on Lead Therapeutic Program at American Society of Nephrology Meeting-

LA JOLLA, Calif., Nov. 8, 2011 /PRNewswire/ — Regulus Therapeutics Inc., a biopharmaceutical company leading the discovery and development of innovative medicines targeting microRNAs, today announced presentations on its preclinical programs for the treatment of fibrosis at the American Association of Nephrology “Kidney Week” Annual Meeting held Nov. 8–13, 2011, in Philadelphia. New data will be presented demonstrating that microRNA-21 (miR-21) is upregulated in human patients and animal models with kidney injury and fibrosis. In preclinical models, genetic deletion of miR-21 or pharmacologic inhibition using proprietary anti-miR oligonucleotides decreased fibrotic gene expression and improved kidney fibrosis. These new data demonstrate that miR-21 contributes to fibrosis and epithelial injury in the kidney, and supports the development of anti-miR-21 oligonucleotides as a therapeutic approach for treating chronic kidney disease.

“In collaboration with Dr. Jeremy S. Duffield, M.D., Ph.D., University of Washington, we have shown that inhibition of miR-21 with our proprietary anti-miR oligonucleotides is effective at preventing [click to continue…]

Incoming search terms for this article:

{ 0 comments }

Center For Skin Sciences - University of Bradford, Yorkshire, UKBone morphogenetic proteins (BMPs) play essential roles in the control of skin development, postnatal tissue remodelling and tumorigenesis. To explore whether some of the effects of BMP signalling are mediated by microRNAs, Natalia V. Botchkareva’s lab at the Centre for Skin Sciences (University of Bradford, Yorkshire, UK), performed genome-wide microRNA (miRNA) screening in primary mouse keratinocytes after BMP4 treatment. Microarray analysis revealed substantial BMP4-dependent changes in the expression of distinct miRNAs, including miR-21. Real-time PCR confirmed that BMP4 dramatically inhibits miR-21 expression in the keratinocytes. Consistently, significantly increased levels of miR-21 were observed in transgenic mice overexpressing the BMP antagonist noggin under control of the K14 promoter (K14-noggin). By in situ hybridization, miR-21 expression was observed in the epidermis and hair follicle epithelium in normal mouse skin. In K14-noggin skin, miR-21 was [click to continue…]

Incoming search terms for this article:

{ 0 comments }

Groundbreaking Research – microRNA-21

by Chris on August 9, 2010

microRNA 21 ArticlemicroRNA-21 is a very popular study target these days, which is not surprising given its overexpression in many human tumors, and was profiled on the miRNA blog back in February as the “microRNA of the week”.

Researchers at Yale have now demonstrated what they call ‘oncomiR addiction’ (the dependence of some cancer types on certain microRNAs for maintenance of the malignant phenotype) for miR-21 by pre-B-cell lymphoma. They show for the first time in vitro that overexpression of miR-21 leads to a pre-B malignant lymphoid-like phenotype and that when miR-21 is inactivated, the tumors regress completely in a few days. Their research not only demonstrates that mir-21 is a genuine oncogene but that tumors can also become addicted to oncomiRs. This and other work supports miR-21 as a drug target for treatment of human cancers.

Medina PP, Nolde M, Slack FJ (2010) OncomiR addiction in an in vivo model of microRNA-21-induced pre-B-cell lymphoma. Nature [Epub ahead of print]. [abstract]

Incoming search terms for this article:

{ 1 comment }

microRNA of the Week: microRNA-21

by Chris on February 5, 2010

5′ – uagcuuaucagacugauguuga – 3′

This week we take a look at an interesting microRNA that has widespread regulatory function and has also been in the headlines of late. microRNA-21 has been linked to a variety of diseases, including cancer, fibrosis, and heart disease and is therefore a potential target for a number of therapeutic indications. Generally, microRNA-21 is overexpressed in most human cancers and downregulates the expression of many tumor suppressors. There are many cancer control genes that are targeted by micro-211. microRNA-21 has a protective effect against ischemia-induced cardiac myocyte damage and may play critical roles in the early phase of acute myocardial infarction2. Also, the potential for microRNA-21 involvement in a major diabetic complication was demonstrated as its expression was downregulated in response to early diabetic nephropathy3. It seems there are clearly clinical applications for this microRNA as companies race to stake their IP claims. Last week two groups issued press releases touting the USPTO’s allowance of their claims related to microRNA-21.

January 25, 2010 – Regulus, Alnylam and Isis Announce U.S. Allowance of Tuschl III Patent Application Covering miR-21

“ miR-21 Patent Allowance Strengthens Regulus Leadership in microRNA Therapeutic Drug Development”

January 29, 2010  -Rosetta Genomics Fortifies Patent Position with U.S. Allowance of Claims Covering Human microRNAs miR-21 and hcmv-miR-UL112

“Rosetta Genomics owns or has access to intellectual property related to microRNAs that is among the broadest of any commercial entity, and these two notices of allowance further solidify our position”

  1. Wickramasinghe NS, Manavalan TT, Dougherty SM, Riggs KA, Li Y, Klinge CM. (2009) Estradiol downregulates miR-21 expression and increases miR-21 target gene expression in MCF-7 breast cancer cells. Nucleic Acids 37(8), 2584-95.  [abstract]
  2. Dong S, Cheng Y, Yang J, Li J, Liu X, Wang X, Wang D, Krall TJ, Delphin ES, Zhang C. (2009) MicroRNA expression signature and the role of microRNA-21 in the early phase of acute myocardial infarctionJ Biol Chem [Epub ahead of print].  [abstract]
  3. Zhang Z, Peng H, Chen J, Chen X, Han F, Xu X, He X, Yan N. (2009) MicroRNA-21 protects from mesangial cell proliferation induced by diabetic nephropathy in db/db mice.  FEBS Lett 583(12), 2009-14.  [abstract]

Incoming search terms for this article:

{ 1 comment }

Business Wire 1/25/09

The newly allowed claims cover miR-21, a microRNA that has been linked to a variety of diseases, including cancer, fibrosis, and heart disease. The claims additionally encompass single-stranded and double-stranded antisense compounds complementary to miR-21. The allowance of this second Tuschl III patent in the U.S. extends the scope of this patent estate, which has already yielded patents directed to miR-122 in the U.S. (U.S. Patent No. 7,232,806), Australia (Australia Patent No. 2002 347 035), and Japan (Japan Patent No. 4 371 812). (read more…)

Incoming search terms for this article:

{ 0 comments }