
Highly sensitive and accurate test detects cancer-related microRNA in blood of patients even before the development of colorectal cancer

DALLAS, June 19, 2013 /PRNewswire-USNewswire/ – A new blood test developed in the Gastrointestinal Cancer Research Lab at Baylor Research Institute is showing very promising results for finding cancer-related microRNA in the blood before a tumor develops in the colon.

The test results, published in the latest issue of the Journal of the National Cancer Institute , are exciting and promising because this simple blood-based test examines the levels of a single microRNA that can be readily identified in a wide variety of bodily fluids, including blood. In this seminal study the investigators studied several hundred patients with colorectal polyps and cancers and reported that measuring levels of miR-21 in the blood can accurately identify up to 92 percent of patients with colorectal cancer. Even more importantly, not only is this test good for non-invasively identifying patients who already have colorectal cancer, but it can accurately identify up to 82 percent of patients with advanced colonic polyps, which present the highest risk for developing into colorectal cancers several years later in life.

“The development of this biomarker is highly encouraging because high mortality rates associated with colorectal cancer is a consequence of late detection of this disease, underscoring the [click to continue…]


CINCINNATI CHILDRENS HOSPITAL MEDICAL CENTER LOGOCINCINNATI, March 9, 2012 /PRNewswire-USNewswire/ – Researchers have identified a genetic signature for a severe, often painful food allergy – eosinophilic esophagitis – that could lead to improved diagnosis and treatment for children unable to eat a wide variety of foods.

The scientists, from Cincinnati Children’s Hospital Medical Center, report in the Journal of Allergy and Clinical Immunology that they have pinpointed a dysregulated microRNA signature for eosinophilic esophagitis (EoE), a disease that also may cause weight loss, vomiting, heartburn and swallowing difficulties.

Interestingly, the dysregulated microRNA was reversible with steroid treatment, according to the study’s senior investigator, Marc E. Rothenberg, MD, PhD, director of Allergy and Immunology and the Center for Eosinophilic Disorders at Cincinnati Children’s. MicroRNAs are short segments of RNA that can regulate whether genetic messengers (mRNAs) are degraded or translated into protein.

“The identification of biomarkers specific to EoE is a significant advancement for both the diagnosis and treatment of the disease,” explains Rothenberg. “The microRNA signature provides an opportunity for more precise analysis of esophageal biopsies.”

Rothenberg said children with EoE now undergo anesthesia and invasive endoscopy to diagnose and monitor the allergy. The ability to determine the presence and status of EoE with a noninvasive method, such as blood test that measures microRNAs, would have a positive impact on individuals and families.

In the current study, investigators analyzed esophageal microRNA expression of patients with active EoE, steroid-induced EoE remission, patients with chronic (non-eosinophilic) esophagitis and of healthy individuals. Additionally, they assessed plasma microRNA expression of patients with active EoE, remission of EoE remission and of healthy individuals.

The researchers found that EoE was associated with 32 differentially regulated microRNAs and distinguishable from the non-eosinophilic forms of esophagitis (such as reflux disease). Esophageal eosinophil levels correlated significantly with [click to continue…]

Incoming search terms for this article:


-New study published in Science Translational Medicine demonstrates microRNA-21 contributes to fibrogenesis in the kidney
-Regulus, in partnership with Sanofi, developing novel anti-fibrotic therapies targeting microRNAs

B.N. Chau et al.
“MicroRNA-21 Promotes Fibrosis of the Kidney by Silencing Metabolic Pathways”
Sci Transl Med 15 February 2012:
Vol. 4, Issue 121, p. 121ra18
Sci. Transl. Med. DOI: 10.1126/scitranslmed.3003205


LA JOLLA, Calif., Feb. 16, 2012  /PRNewswire/ — Regulus Therapeutics Inc., a biopharmaceutical company leading the discovery and development of innovative medicines targeting microRNAs, today announced that new preclinical data investigating the role of microRNA-21 (miR-21) in the treatment of kidney fibrosis has been published in the journal Science Translational Medicine. Regulus’ lead program for fibrosis targets miR-21, which is up-regulated in fibrotic tissues of humans. Previous preclinical studies by Regulus scientists and collaborators have shown that therapeutic oligonucleotides targeting miR-21 (anti-miR-21) can decrease fibrosis in preclinical models by reducing the expression of extracellular matrix proteins.  Despite the current burden of fibrosis-related human disease, there are few therapies that can specifically treat this devastating disease.

“We are pleased with the published results demonstrating that targeting miR-21 with proprietary anti-miR oligonucleotides is effective at preventing kidney fibrosis in preclinical models,” said Neil W. Gibson, Ph.D., Regulus’ Chief Scientific Officer.  ”We plan to select an anti-miR-21 development candidate [click to continue…]


-Regulus Scientists to Provide Update on Lead Therapeutic Program at American Society of Nephrology Meeting-

LA JOLLA, Calif., Nov. 8, 2011 /PRNewswire/ — Regulus Therapeutics Inc., a biopharmaceutical company leading the discovery and development of innovative medicines targeting microRNAs, today announced presentations on its preclinical programs for the treatment of fibrosis at the American Association of Nephrology “Kidney Week” Annual Meeting held Nov. 8–13, 2011, in Philadelphia. New data will be presented demonstrating that microRNA-21 (miR-21) is upregulated in human patients and animal models with kidney injury and fibrosis. In preclinical models, genetic deletion of miR-21 or pharmacologic inhibition using proprietary anti-miR oligonucleotides decreased fibrotic gene expression and improved kidney fibrosis. These new data demonstrate that miR-21 contributes to fibrosis and epithelial injury in the kidney, and supports the development of anti-miR-21 oligonucleotides as a therapeutic approach for treating chronic kidney disease.

“In collaboration with Dr. Jeremy S. Duffield, M.D., Ph.D., University of Washington, we have shown that inhibition of miR-21 with our proprietary anti-miR oligonucleotides is effective at preventing [click to continue…]


Center For Skin Sciences - University of Bradford, Yorkshire, UKBone morphogenetic proteins (BMPs) play essential roles in the control of skin development, postnatal tissue remodelling and tumorigenesis. To explore whether some of the effects of BMP signalling are mediated by microRNAs, Natalia V. Botchkareva’s lab at the Centre for Skin Sciences (University of Bradford, Yorkshire, UK), performed genome-wide microRNA (miRNA) screening in primary mouse keratinocytes after BMP4 treatment. Microarray analysis revealed substantial BMP4-dependent changes in the expression of distinct miRNAs, including miR-21. Real-time PCR confirmed that BMP4 dramatically inhibits miR-21 expression in the keratinocytes. Consistently, significantly increased levels of miR-21 were observed in transgenic mice overexpressing the BMP antagonist noggin under control of the K14 promoter (K14-noggin). By in situ hybridization, miR-21 expression was observed in the epidermis and hair follicle epithelium in normal mouse skin. In K14-noggin skin, miR-21 was [click to continue…]

Incoming search terms for this article:


Groundbreaking Research – microRNA-21

August 9, 2010

microRNA-21 is a very popular study target these days, which is not surprising given its overexpression in many human tumors, and was profiled on the miRNA blog back in February as the “microRNA of the week”. Researchers at Yale have now demonstrated what they call ‘oncomiR addiction’ (the dependence of some cancer types on certain […]

Read the full article →

microRNA of the Week: microRNA-21

February 5, 2010

5′ – uagcuuaucagacugauguuga – 3′ This week we take a look at an interesting microRNA that has widespread regulatory function and has also been in the headlines of late. microRNA-21 has been linked to a variety of diseases, including cancer, fibrosis, and heart disease and is therefore a potential target for a number of therapeutic […]

Read the full article →

Regulus, Alnylam and Isis Announce U.S. Allowance of Tuschl III Patent Application Covering miR-21

January 25, 2010

Business Wire 1/25/09 The newly allowed claims cover miR-21, a microRNA that has been linked to a variety of diseases, including cancer, fibrosis, and heart disease. The claims additionally encompass single-stranded and double-stranded antisense compounds complementary to miR-21. The allowance of this second Tuschl III patent in the U.S. extends the scope of this patent […]

Read the full article →