Achieves Key ‘Clinical Map Initiative’ Goal for 2015 and Advances Orphan Disease Efforts

regulus therapeutics logoLA JOLLA, Calif., June 4, 2015 /PRNewswire/ – Regulus Therapeutics Inc. (NASDAQ: RGLS), a biopharmaceutical company leading the discovery and development of innovative medicines targeting microRNAs, announced today that dosing has begun in a first-in-human Phase I clinical study of RG-012, a single stranded, chemically modified oligonucleotide that binds to and inhibits the function of microRNA-21 (“miR-21″).  RG-012 is being developed by Regulus in a strategic alliance with Genzyme, a Sanofi company, for the treatment of Alport syndrome, a life-threatening genetic kidney disease with no approved therapy.  The Phase I clinical study is being conducted in the United States as a randomized, double-blind, placebo-controlled, single ascending dose study to evaluate the safety, tolerability and pharmacokinetics of subcutaneous dosing of RG-012 in healthy volunteers.

“Advancement of RG-012 into the clinic represents an important achievement under our ‘Clinical Map Initiative’ and further underscores our focus on discovering and developing novel microRNA therapies for orphan and rare diseases such as Alport syndrome,” said Paul Grint, M.D., President and Chief Executive Officer of Regulus.  “We expect that the results from this first-in-human clinical study [click to continue…]


Regulus Receives Orphan Medicinal Product Designation from the European Commission for RG-012, a microRNA Therapeutic in Development for the Treatment of Alport Syndrome

regulus therapeutics logoLA JOLLA, Calif., March 25, 2015 /PRNewswire/ – Regulus Therapeutics Inc. (NASDAQ:RGLS), a biopharmaceutical company leading the discovery and development of innovative medicines targeting microRNAs, announced today that the European Commission has granted orphan medicinal product designation for RG-012, a single stranded, chemically modified oligonucleotide that binds to and inhibits the function of microRNA-21 (“miR-21″) for the treatment of Alport syndrome, a life-threatening genetic kidney disease with no approved therapy. In July 2014, the U.S. Food & Drug Administration granted orphan drug designation to RG-012 for the treatment of Alport syndrome.

“We are pleased to have received orphan medicinal product designation in the European Union for RG-012, a key microRNA therapeutic program under our ‘Clinical Map Initiative’,” said Paul Grint, M.D., Chief Medical Officer of Regulus. “Alport syndrome is a life threatening disease and patients have very limited treatment options because there is currently no approved therapy.  We believe that RG-012 represents an opportunity to make a significant impact in the lives of patients with Alport syndrome and we look forward to advancing this program into the clinic.”

Regulus is currently enrolling patients in a natural history of disease study called ATHENA to gather information about the changes in renal function over time in patients with Alport syndrome.  Data from [click to continue…]


Regulus Announces Key Goals Under its ‘Clinical Map Initiative’ for 2015

Accelerates RG-101 for HCV with Dual-Track Clinical Development Strategy; Top-Line, Single Dose, 4 mg/kg Results as Well as 2mg/kg

Extended Follow Up Results from Ongoing Study to be Reported in Early February 2015

Regulus Therapeutics LogoLA JOLLA, Calif., Jan. 8, 2015 /PRNewswire/ – Regulus Therapeutics Inc. (NASDAQ:RGLS), a biopharmaceutical company leading the discovery and development of innovative medicines targeting microRNAs, today announced key goals for 2015 under its ‘Clinical Map Initiative’ to advance its microRNA therapeutics portfolio and biomarkers platform.

“Regulus enters 2015 with the scientific and financial strength to realize the transformative potential of microRNAs.  As such, we’ve set aggressive goals for the year focused on creating a clear path to value for what we believe to be our greatest opportunities,” said Kleanthis G. Xanthopoulos, Ph.D., President and CEO of Regulus.  “Under our ‘Clinical Map Initiative’, we are focusing our near term efforts on accelerating RG-101 for HCV with a Phase II dual-track clinical development strategy, while advancing our overall therapeutics pipeline and aligning our biomarker efforts to streamline our clinical development decisions.”

Key Goals Under Regulus’ ‘Clinical Map Initiative’ for 2015

  • ‘Clinical Map’ of RG-101 for HCV Defined: Dual-Track Strategy Accelerates Phase II Development; Multiple Data Read-Outs in 2015.  Following the favorable interim results reported inOctober 2014 from its ongoing clinical study, Regulus has accelerated development of RG-101, a wholly-owned, GalNAc-conjugated anti-miR targeting microRNA-122 (“miR-122″) for the treatment of HCV.  Regulus is pursuing a Phase II dual-track development strategy (i) to investigate RG-101 in combination with oral agents to potentially shorten treatment durations, optimize clinical outcomes and potentially improve responses in certain underserved HCV patient populations; and (ii) to investigate RG-101 further as a single agent to determine [click to continue…]


Highly sensitive and accurate test detects cancer-related microRNA in blood of patients even before the development of colorectal cancer

DALLAS, June 19, 2013 /PRNewswire-USNewswire/ – A new blood test developed in the Gastrointestinal Cancer Research Lab at Baylor Research Institute is showing very promising results for finding cancer-related microRNA in the blood before a tumor develops in the colon.

The test results, published in the latest issue of the Journal of the National Cancer Institute , are exciting and promising because this simple blood-based test examines the levels of a single microRNA that can be readily identified in a wide variety of bodily fluids, including blood. In this seminal study the investigators studied several hundred patients with colorectal polyps and cancers and reported that measuring levels of miR-21 in the blood can accurately identify up to 92 percent of patients with colorectal cancer. Even more importantly, not only is this test good for non-invasively identifying patients who already have colorectal cancer, but it can accurately identify up to 82 percent of patients with advanced colonic polyps, which present the highest risk for developing into colorectal cancers several years later in life.

“The development of this biomarker is highly encouraging because high mortality rates associated with colorectal cancer is a consequence of late detection of this disease, underscoring the [click to continue…]


CINCINNATI CHILDRENS HOSPITAL MEDICAL CENTER LOGOCINCINNATI, March 9, 2012 /PRNewswire-USNewswire/ – Researchers have identified a genetic signature for a severe, often painful food allergy – eosinophilic esophagitis – that could lead to improved diagnosis and treatment for children unable to eat a wide variety of foods.

The scientists, from Cincinnati Children’s Hospital Medical Center, report in the Journal of Allergy and Clinical Immunology that they have pinpointed a dysregulated microRNA signature for eosinophilic esophagitis (EoE), a disease that also may cause weight loss, vomiting, heartburn and swallowing difficulties.

Interestingly, the dysregulated microRNA was reversible with steroid treatment, according to the study’s senior investigator, Marc E. Rothenberg, MD, PhD, director of Allergy and Immunology and the Center for Eosinophilic Disorders at Cincinnati Children’s. MicroRNAs are short segments of RNA that can regulate whether genetic messengers (mRNAs) are degraded or translated into protein.

“The identification of biomarkers specific to EoE is a significant advancement for both the diagnosis and treatment of the disease,” explains Rothenberg. “The microRNA signature provides an opportunity for more precise analysis of esophageal biopsies.”

Rothenberg said children with EoE now undergo anesthesia and invasive endoscopy to diagnose and monitor the allergy. The ability to determine the presence and status of EoE with a noninvasive method, such as blood test that measures microRNAs, would have a positive impact on individuals and families.

In the current study, investigators analyzed esophageal microRNA expression of patients with active EoE, steroid-induced EoE remission, patients with chronic (non-eosinophilic) esophagitis and of healthy individuals. Additionally, they assessed plasma microRNA expression of patients with active EoE, remission of EoE remission and of healthy individuals.

The researchers found that EoE was associated with 32 differentially regulated microRNAs and distinguishable from the non-eosinophilic forms of esophagitis (such as reflux disease). Esophageal eosinophil levels correlated significantly with [click to continue…]

Incoming search terms for this article:


Regulus Announces New Publication Showing Potential Therapeutic Benefit of Targeting microRNA-21 in Fibrosis

February 16, 2012

-New study published in Science Translational Medicine demonstrates microRNA-21 contributes to fibrogenesis in the kidney -Regulus, in partnership with Sanofi, developing novel anti-fibrotic therapies targeting microRNAs B.N. Chau et al. “MicroRNA-21 Promotes Fibrosis of the Kidney by Silencing Metabolic Pathways” Sci Transl Med 15 February 2012: Vol. 4, Issue 121, p. 121ra18 Sci. Transl. Med. […]

Read the full article →

Regulus Therapeutics to Present New In Vivo Data for microRNA-21 in Kidney Fibrosis

November 8, 2011

-Regulus Scientists to Provide Update on Lead Therapeutic Program at American Society of Nephrology Meeting- LA JOLLA, Calif., Nov. 8, 2011 /PRNewswire/ — Regulus Therapeutics Inc., a biopharmaceutical company leading the discovery and development of innovative medicines targeting microRNAs, today announced presentations on its preclinical programs for the treatment of fibrosis at the American Association […]

Read the full article →

MicroRNA-21 is an important downstream component of BMP signalling in epidermal keratinocytes

October 26, 2011

Bone morphogenetic proteins (BMPs) play essential roles in the control of skin development, postnatal tissue remodelling and tumorigenesis. To explore whether some of the effects of BMP signalling are mediated by microRNAs, Natalia V. Botchkareva’s lab at the Centre for Skin Sciences (University of Bradford, Yorkshire, UK), performed genome-wide microRNA (miRNA) screening in primary mouse […]

Read the full article →

Groundbreaking Research – microRNA-21

August 9, 2010

microRNA-21 is a very popular study target these days, which is not surprising given its overexpression in many human tumors, and was profiled on the miRNA blog back in February as the “microRNA of the week”. Researchers at Yale have now demonstrated what they call ‘oncomiR addiction’ (the dependence of some cancer types on certain […]

Read the full article →

microRNA of the Week: microRNA-21

February 5, 2010

5′ – uagcuuaucagacugauguuga – 3′ This week we take a look at an interesting microRNA that has widespread regulatory function and has also been in the headlines of late. microRNA-21 has been linked to a variety of diseases, including cancer, fibrosis, and heart disease and is therefore a potential target for a number of therapeutic […]

Read the full article →