Industry Press Update

by Chris on February 17, 2011

in Press Release

02/17/2011 – 09:00 AM
miRagen Therapeutics Receives Orphan Drug Designation for MGN-4893 for the Treatment of Polycythemia Vera

02/10/2011 – 04:00 PM
Alnylam to Webcast Conference Call Discussing Fourth Quarter and 2010 Financial Results

02/10/2011 – 08:30 AM
Regulus Therapeutics to Present Multiple Platform and Pipeline Advancements at the Keystone Symposium on microRNAs

02/08/2011 – 04:00 PM
Alnylam to Webcast Presentation at the 13th Annual BIO CEO & Investor Conference

01/27/2011 – 07:15 AM
RXi Pharmaceuticals Announces Positive Initial Results in microRNA Therapeutics

01/25/2011 – 08:00 AM
Alnylam Receives Positive Opinion for Orphan Drug Designation from European Medicines Agency for ALN-TTR01, an RNAi Therapeutic for the Treatment of Transthyretin-Mediated Amyloidosis

01/25/2011 – 07:30 AM
NanoString Technologies Introduces Multiplexed Assay Kit for Mouse microRNA Analysis

Industry Press

by Chris on January 18, 2011

in News

1/18/2011 – 01:45 PM

miRagen Therapeutics Named University of Colorado Technology Transfer Office Bioscience Company of the Year

01/18/2011 – 08:00 AM

Mirna Therapeutics and Collaborators Publish New Data on miR-34 and its Role in Cancer Stem Cells

01/12/2011 – 02:00 PM

Asuragen Announces New Notices of Allowance from USPTO Related to the Diagnostic Applications of Cancer-Related miRNAs at the JP Morgan Healthcare Conference

01/06/2011 – 07:30 AM

Alnylam Launches “Alnylam 5×15” Product Strategy and Provides Guidance and Goals for 2011

01/05/2011 – 12:30 PM

Research and Markets: Biochips – Technologies, Markets and Companies – Updated Report with Projected Value to 2015 and 2020

01/05/2011 – 08:30 AM

Regulus Therapeutics Promotes Garry E. Menzel, Ph.D., to Chief Operating Officer and Executive Vice President of Finance

01/04/2011 – 03:27 PM

Research and Markets: RNAi – An Updated Report on Technologies, Markets and Companies

01/04/2011 – 07:30 AM

Alnylam Demonstrates RNAi in Man with Systemically Delivered RNAi Therapeutics

from BusinessWire

miR-122 is a liver-expressed microRNA that has been shown to be a critical endogenous “host factor” for the replication of hepatitis C virus (HCV), and anti-miRs targeting miR-122 have been shown to block HCV infection (Jopling et al. (2005) Science 309, 1577-81). In earlier work, scientists at Alnylam Pharmaceuticals and Isis Pharmaceuticals demonstrated the ability to antagonize miR-122 in vivo using chemically modified single-stranded anti-miR oligonucleotides. Data from multiple preclinical studies have shown a robust HCV antiviral effect following inhibition of miR-122.

Regulus Therapeutics Inc. is developing a microRNA therapeutic targeting miR-122 for the treatment of HCV infection and plans to file an investigational new drug (IND) application in 2011.

Today, Regulus announced that the European Patent Office (EPO) and United States Patent and Trademark Office (USPTO) have recently granted claims for microRNA-122 therapy in hepatitis C viral (HCV) infections.  These two new patents will further strengthen the Regulus-controlled patent estate surrounding miR-122 compositions and methods of use, which include:

  • The ‘Sarnow’ patent claiming the use of anti-miR-122 to inhibit HCV replication (US Patent No. 7,307,067)
  • The ‘Esau’ patent claiming the use of anti-miRs targeting miR-122 as inhibitory agents (US Patent No. 7,683,036)
  • The ‘Tuschl III’ patent claiming compositions of matter for miR-122 and complementary oligonucleotides (US Patent No. 7,232,806)
  • The ‘Manoharan’ patent claiming antagomirs, including antagomirs targeting miR-122 (US Patent No. 7,582,744)
  • A recently granted Regulus-owned European application claiming the use of miR-122 antagonists for reducing cholesterol (EP Application No. 06813949.2)

(read the entire press release)

Incoming search terms for this article:

Targeting a Master Regulator of Disease

by Chris on July 7, 2010

in News

Drugmakers place big bets on the emerging science of microRNA.

By Arlene Weintraub

San Diego startup Regulus, founded in 2007, has quietly been working on a new way to target RNA for drug development. The company has been studying a subset of RNA molecules called microRNAs, or miRNAs. First discovered in the 1990s, misbehaving miRNAs have been linked to several diseases, including cancer and heart failure. Drug developers hope these molecules will prove to be particularly effective drug targets because manipulating just one seems to suppress several disease-linked proteins–whereas most biotech drugs only target individual proteins. [click to continue…]

Sanofi-Aventis and Regulus Therapeutics Form Major Strategic Alliance on microRNA Therapeutics

Carlsbad, CA., June 22, 2010 – Regulus Therapeutics Inc. and sanofi-aventis (EURONEXT: SAN and NYSE: SNY) announced today that they have entered into a global, strategic alliance to discover, develop, and commercialize microRNA therapeutics.  The alliance represents the largest microRNA partnership formed to date, valued at potentially over $750 million, and includes a $25 million upfront fee, a $10 million future equity investment subject to mutual agreement on company valuation, and annual research support for three years with the option to extend two additional years.  The alliance will initially focus on the therapeutic area of fibrosis.  Regulus and sanofi-aventis will collaborate on up to four microRNA targets, including Regulus’ lead fibrosis program targeting microRNA-21.  sanofi-aventis also receives an option for a broader technology alliance that provides Regulus certain rights to participate in development and commercialization of resulting products.  If exercised, this three-year option is worth an additional $50 million to Regulus. (read more… )

Incoming search terms for this article:

Nice microRNA Video

April 16, 2010

Incoming search terms for this article:microrna videomiRNA videoVideo mirnamiRNA videosmicro rna video

Read the full article →

microRNA of the Week: microRNA-21

February 5, 2010

5′ – uagcuuaucagacugauguuga – 3′ This week we take a look at an interesting microRNA that has widespread regulatory function and has also been in the headlines of late. microRNA-21 has been linked to a variety of diseases, including cancer, fibrosis, and heart disease and is therefore a potential target for a number of therapeutic […]

Read the full article →