USPTO

microRNA of the Week: microRNA-21

by Chris on February 5, 2010

in Technical Article

5′ – uagcuuaucagacugauguuga – 3′

This week we take a look at an interesting microRNA that has widespread regulatory function and has also been in the headlines of late. microRNA-21 has been linked to a variety of diseases, including cancer, fibrosis, and heart disease and is therefore a potential target for a number of therapeutic indications. Generally, microRNA-21 is overexpressed in most human cancers and downregulates the expression of many tumor suppressors. There are many cancer control genes that are targeted by micro-211. microRNA-21 has a protective effect against ischemia-induced cardiac myocyte damage and may play critical roles in the early phase of acute myocardial infarction2. Also, the potential for microRNA-21 involvement in a major diabetic complication was demonstrated as its expression was downregulated in response to early diabetic nephropathy3. It seems there are clearly clinical applications for this microRNA as companies race to stake their IP claims. Last week two groups issued press releases touting the USPTO’s allowance of their claims related to microRNA-21.

January 25, 2010 – Regulus, Alnylam and Isis Announce U.S. Allowance of Tuschl III Patent Application Covering miR-21

“ miR-21 Patent Allowance Strengthens Regulus Leadership in microRNA Therapeutic Drug Development”

January 29, 2010  -Rosetta Genomics Fortifies Patent Position with U.S. Allowance of Claims Covering Human microRNAs miR-21 and hcmv-miR-UL112

“Rosetta Genomics owns or has access to intellectual property related to microRNAs that is among the broadest of any commercial entity, and these two notices of allowance further solidify our position”

  1. Wickramasinghe NS, Manavalan TT, Dougherty SM, Riggs KA, Li Y, Klinge CM. (2009) Estradiol downregulates miR-21 expression and increases miR-21 target gene expression in MCF-7 breast cancer cells. Nucleic Acids 37(8), 2584-95.  [abstract]
  2. Dong S, Cheng Y, Yang J, Li J, Liu X, Wang X, Wang D, Krall TJ, Delphin ES, Zhang C. (2009) MicroRNA expression signature and the role of microRNA-21 in the early phase of acute myocardial infarctionJ Biol Chem [Epub ahead of print].  [abstract]
  3. Zhang Z, Peng H, Chen J, Chen X, Han F, Xu X, He X, Yan N. (2009) MicroRNA-21 protects from mesangial cell proliferation induced by diabetic nephropathy in db/db mice.  FEBS Lett 583(12), 2009-14.  [abstract]

Incoming search terms for this article:

{ 1 comment }